Command: rna

Usage:
rna  operation  arguments

The rna command builds rough but potentially large-scale models of single-stranded RNA, given base-pairing information. See also: build

The operation can be:

• model – create an atomic model of single-stranded RNA from base-pairing information or a previously calculated path
• path – create a path of markers representing stems and loops from base-pairing information

• rna model  sequence  path  marker-spec [ startSequence  i ] [ name  n ]
  – or –
• rna model  sequence  pairs  pair-list [ startSequence  i ] [ name  n ] [ stemColor  color-spec ] [ loopColor  color-spec ] [ pColor  color-spec ] [ length  l ] [ pattern  circle | helix  | line | sphere ]  pattern-options  [ loopPattern  helix  | horseshoe ]  loop-pattern-options  [ branchTilt  angle_b ] [ loopTwist  angle_l ]

Create an atomic model of single-stranded RNA. The sequence can be a string of upper-case letters (such as AGCTU) or the pathname of a FASTA file containing the desired sequence, as in the example below. The startSequence option (default 1) indicates where to start within the supplied sequence. The name option gives the name of the resulting molecule model (default RNA).

Either a path or pairs must be supplied.

• The path to be followed by the RNA is specified as a series of markers previously generated with rna path, which also assigns the nucleotide orientations required to create the model.
• The pairs pair-list specification is the same as for rna path. Base-paired and non-base-paired nucleotides in the resulting structure will be colored according to the stemColor and loopColor values (defaults yellow and cornflower blue ), respectively, and phosphorus atoms according to pColor (default orange ). The remaining options are the same as described for rna path.

Algorithm: The path of the RNA is either precomputed with rna path or computed implicitly using the same algorithm as that command. The algorithm generates a series of markers and assigns an orientation to each marker (details...). Atomic model templates are placed in the computed orientations on top of the markers. In stem regions, the orientations are chosen to form base-pairing hydrogen bonds. The atomic templates are in the file rna_templates_6pj6.cif within the ChimeraX rna_layout bundle.

Create a path of markers, one marker per nucleotide, to represent an RNA molecule with specified base-pairing interactions. The pair-list can be either a comma-separated list of numbers or the pathname of a text file containing three columns, one line per stem, as in the example below.

Consecutive markers and base-paired markers are connected by links. Stretches of base-paired nucleotides are stems, whereas nucleotides that are not base-paired are said to belong to loops. Stems are described with triples of integers. For example, 1,50,10 indicates pairing nucleotide 1 with nucleotide 50 at the start of a 10-bp stem, such that 2 and 49, 3 and 48, ... 10 and 41 are also paired. Multiple stems can be specified with additional triples (e.g., 1,50,10,60,70,2 describes two stems), and any number of stems can be given. A limitation is that residues within a stem range cannot be paired with residues beyond that range; for example, if a stem starts at 1,50, no other stem can pair residues in the range 1-50 with residues outside that range.

Residue numbers in the resulting marker set start at 1. The last residue number is the highest number specified for a stem, unless a higher number is given with the length option. The markerRadius option specifies marker radius (default 2.0 Å). Paired and unpaired markers are colored according to the stemColor and loopColor values (defaults yellow and cornflower blue ), respectively, and the name option gives the name of the resulting marker model (default RNA path).

The pattern option controls the overall RNA layout:

• circle (default)
• helix – with associated pattern-options:
  • [ helixRadius  rad_h ] (default 300.0 Å)
  • [ helixRise  rise ] (default 50.0 Å) – rise per helical turn
• line – linear
• sphere – a spiral on a sphere with associated pattern-options:
  • [ sphereTurnSpacing  spacing ] (default 60.0 Å) – distance on the sphere between adjacent turns of the spiral
  • [ sphereRadius  rad_s ] (default calculated from the sequence length and turn spacing)
  • [ sphereTurns  turns ] (default calculated from the sequence length and turn spacing) – number of times the RNA wraps around the sphere from pole to pole; does not have to be an integer

    Specifying a sphere radius and number of turns that do not accommodate the full sequence will give an error, but values that leave extra room on the sphere are accepted.

Stem and loop orientations are produced by random rotations, where each angle of rotation is obtained by multiplying the branchTilt angle_b (default 0°) by a random number uniformly distributed between –1 and 1.

The loopPattern option controls the layout of non-base-paired segments of the sequence:

• helix (default) – with associated loop-pattern-options:
  • [ helixLoopSize  N_loop ] (default 8) – minimum number of nucleotides per helical turn: in a given loop, this number or 2x or 3x the value may be used (the largest possible) if the loop contains at least that many residues. For example, if the parameter is 8, there will be 24 nucleotides per turn in loops of 24 or more residues, 16 per turn in loops of 16-23 residues, and 8 per turn in loops of 15 residues or fewer.
  • [ helixLoopRise  rise_loop ] (default 20.0 Å) – rise per helical turn
• horseshoe – U-shaped, with associated loop-pattern-options
  • [ horseshoeSideSize  N_side ] (default 10) – number of nucleotides in each side of the “U”
  • [ horseshoeCurveSize  N_curve ] (default 8) – number of nucleotides in the curve of the “U”
  • [ horseshoeSpacing  N_spacing ] (default 1) – number of nucleotides between horseshoes, i.e. when the stretch of unpaired residues is longer than the number of nucleotides allocated to a single horseshoe

Orientations of individual nucleotides within a loop are produced by random rotations about the P-P line, where each angle of rotation is obtained by multiplying the loopTwist angle_l (default 0°) by a random number uniformly distributed between –1 and 1.

Algorithm: The markers are P backbone atom positions and are spaced so that backbone bond lengths are reasonable. Stem regions are generated as twisted double helices rotating 31.5° per base pair, with pairs 2.55 Å apart along the helix axis. The overall layout of the series of loops and stems is given by the pattern option. Loops and stems radiate directly outward from the pattern, with additional variations in angle according to the branchTilt parameter. The loopPattern option specifies loop layout, with the twist of each nucleotide in the loop varying according to the loopTwist parameter.

Example

rna path pairings.txt length 100
rna model hiv-pNL4-3.fasta #1 start 455

These example commands generate a model for the first 100 nucleotides of HIV RNA, with secondary structure as described in:

Architecture and secondary structure of an entire HIV-1 RNA genome. Watts JM, Dang KK, Gorelick RJ, Leonard CW, Bess JW Jr, Swanstrom R, Burch CL, Weeks KM. Nature. 2009 Aug 6;460(7256):711-6.

...using a base-pairing file named pairings.txt containing:

1       57      3
5       54      11
17      43      5
25      38      4
58      104     8
67      94      3
70      90      4

...and a sequence file named hiv-pNL4-3.fasta containing:

>gi|296556482|gb|AF324493.2| HIV-1 vector pNL4-3, 1-9709
TGGAAGGGCTAATTTGGTCCCAAAAAAGACAAGAGATCCTTGATCTGTGGATCTACCACACACAAGGCTA
CTTCCCTGATTGGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTTC
AAGTTAGTACCAGTTGAACCAGAGCAAGTAGAAGAGGCCAATGAAGGAGAGAACAACAGCTTGTTACACC
CTATGAGCCAGCATGGGATGGAGGACCCGGAGGGAGAAGTATTAGTGTGGAAGTTTGACAGCCTCCTAGC
ATTTCGTCACATGGCCCGAGAGCTGCATCCGGAGTACTACAAAGACTGCTGACATCGAGCTTTCTACAAG
GGACTTTCCGCTGGGGACTTTCCAGGGAGGTGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGAT
GCTACATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGC
TCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTCAAAGTAGTGTG